retroviral expression vector pbp fgfr2c wt 2c  (Addgene inc)

Journal: International journal of biological sciences

Article Title: SB Digestor: a tailored driver gene identification tool for dissecting heterogeneous Sleeping Beauty transposon-induced tumors.

doi: 10.7150/ijbs.81317

Figure Lengend Snippet: Figure 5. Candidate gene validation. A. Venn diagram indicating CIS genes for the BrWSB and BrMSB groups by using SB Digestor. B. Oncoplot shows the top overlapping 35 genes in both BrWSB and BrMSB tumors and their frequency in all tumor samples. C. Venn diagram showing the candidate genes identified by SB Digestor and previously by TAPDANCE. D. Venn diagram showing 18 overlapping genes among the 35 common genes identified by SB Digestor (Fig. 5A) and 50 common genes (Fig. 5C). E-F. SB transposon insertion patterns (appearing at more than 0.2%) in Arhgap42 and Tcf12. G. Candidate tumor suppressor genes were knocked out by using the CRISPR‒Cas9 system in G600 cells to evaluate their function. Cell proliferation was monitored with real-time cell analysis. H. Candidate gene knockout tumor cells and control cells were inoculated into nude mice for tumorigenesis evaluation.

Article Snippet: Gene knockout and functional validation Candidate genes were knocked out by using the CRISPR‒Cas9 system with sgRNA, Arhgap42-sg1 (AGTCACTGAAAGAATTCGCA), Arhgap42-sg2 (GACTTCCAGTTTGAGTGTAT), Tcf12-sg1 (AGTA GTCAGTTCAGCGGGTC) and Tcf12-sg2 (ACTTAC TCTAGATGAATCAT) or overexpressed with pBp-FGFR2c-WT in the G600 cell lines (Addgene plasmid No. 45699).

Techniques: Biomarker Discovery, Cell Analysis, Gene Knockout, Control

Journal: Nucleic Acids Research

Article Title: HiFENS: high-throughput FISH detection of endogenous pre-mRNA splicing isoforms

doi: 10.1093/nar/gkac869

Figure Lengend Snippet: Quantitative Measurement of FGFR2 Isoforms by qRT-PCR and RNA-HCR-FISH. (A) Schematic representation of the mutually exclusive FGFR2 splicing event and HCR probe pair location. Boxes indicate exons. Numbers and letters indicate exons number or name. Red boxes represent exons located upstream and downstream of the splicing cassette. Grey boxes represent the constitutive flanking exons 7 and 10. Green and blue boxes represent exon IIIb or exon IIIc, respectively, whose inclusion led to formation of the FGFR2-IIIb or FGFR2-IIIc isoforms, respectively. Triangles over the boxes represents RNA-HCR-FISH probe locations. Green represents FGFR2-IIIb specific probes, red represents FGFR2-Full probes, blue represents FGFR2-IIIc specific probe locations. (B) RNA-HCR-FISH. The black curved line represents the mRNA target molecule, Orange curved lines represent split probes. The blue line represents the linker, while the blue dashed curved line represents the initiator. Black and red lines represent the fluorescently labeled amplifiers in an open state. (C–E) Quantitative RT-PCR for FGFR2-Full (C), FGFR2-IIIb (D) and FGFR2-IIIc (E) isoforms from the indicated cell lines. Expression levels are normalized to expression of TBP, and relative to the expression in AN3 CA cells which was arbitrarily set at one. Note the differences in the scale of the Y axes. Values represent mean ± SEM of three replicates. (F–H) Representative fields of view of RNA-HCR-FISH for FGFR2-Full (F), FGFR2-IIIb (G) and FGFR2-IIIc (H). Indicated cell lines were seed on 384-well plates and 24 h later were subjected to RNA-HCR-FISH (Scale bar: 20 μm). (I–K) Histogram and density plot of RNA-HCR-FISH quantitative spot count measurements for FGFR2-Full (I), FGFR2-IIIb (J) and FGFR2-IIIc (K) isoforms in the indicated cell lines. Values are generated from single cell data and are representative of four replicates. At least 700 cells were analyzed per sample.

Article Snippet: Plasmids and virus production Mammalian expression vectors for FGFR2 -IIIb (pBp-FGFR2b-WT, Addgene plasmid # 45698), FGFR2 -IIIc (pBp-FGFR2c-WT, Addgene plasmid # 45699) and empty vector (pBABE-puro, Addgene plasmid # 51070) were used.

Techniques: Quantitative RT-PCR, Labeling, Expressing, Generated

Journal: Nucleic Acids Research

Article Title: HiFENS: high-throughput FISH detection of endogenous pre-mRNA splicing isoforms

doi: 10.1093/nar/gkac869

Figure Lengend Snippet: Effect of probe numbers on spot count. (A) Schematic representation of FGFR2 isoform-specific probe locations. Boxes indicate exons. Black lines between boxes indicated introns. Numbers and letters insides boxes indicate exon number or name. Green and blue lines represent exon IIIb or exon IIIc probe locations, respectively. Dashed lines indicate split HCR probes pairs. (B, C, F, G) Violin and box plots for spot count measurements for FGFR2-IIIb in T-47D cells (B), FGFR2-IIIc in AN3-CA cells (C), FGFR2-IIIc in T-47D cells (F), or FGFR2-IIIb in AN3-CA cells (G) in different combination of probe sets (x-axis). Box plot inside each violin plot indicate the 25th, 50th (median) and 75th percentile of the distributions and whiskers extend to 1.5X the inter-quantile range (IQR). Numbers in legend indicate number of probes per setting. Values are generated from single cell data and are representative of 4 replicates. At least 1000 cells were analyzed per sample. (D, E) Representative fields of view of RNA-HCR-FISH for FGFR2-IIIb in T-47D cells (F) and FGFR2-IIIc in AN3-CA cells (G) (scale bar: 20 μm).

Article Snippet: Plasmids and virus production Mammalian expression vectors for FGFR2 -IIIb (pBp-FGFR2b-WT, Addgene plasmid # 45698), FGFR2 -IIIc (pBp-FGFR2c-WT, Addgene plasmid # 45699) and empty vector (pBABE-puro, Addgene plasmid # 51070) were used.

Techniques: Generated

Journal: Nucleic Acids Research

Article Title: HiFENS: high-throughput FISH detection of endogenous pre-mRNA splicing isoforms

doi: 10.1093/nar/gkac869

Figure Lengend Snippet: Multiplexing of RNA-HCR-FISH probes. (A–C) Box plot for RNA-HCR-FISH spot count measurements for multiplexed probes for FGFR2-D7-10 (A), FGFR2-IIIb (B) and PGK1 (C) in cells described in Figure ​Figure3.3. X-axes indicate probe combinations. Boxes show the 25th, 50th (median) and 75th percentile of the distributions and whiskers extend to 1.5X inter-quantile range (IQR), outliers are represented as dots. Values are generated from single cell data and are representative of three replicates. At least 500 cells were analyzed per sample (none: no probes. All: multiplexed probes for FGFR2-D7-10, FGFR2-IIIb and PGK1). (D) Representative field of view of RNA-HCR-FISH for FGFR2-Full, FGFR2-IIIb and PGK1 in U2OS cell overexpressing FGFR2-IIIb. Scale bar: 20 μm. (E) Scatter plot of RNA-HCR-FISH spot count measurements for FGFR2-D7-10 (x-axis) and FGFR2-IIIb (y-axis) in U2OS cells over expressing FGFR2-IIIb. Correlation coefficient (r = 0.87) and P-value (P < 2.2e–16) are from a Spearman correlation coefficient test.

Article Snippet: Plasmids and virus production Mammalian expression vectors for FGFR2 -IIIb (pBp-FGFR2b-WT, Addgene plasmid # 45698), FGFR2 -IIIc (pBp-FGFR2c-WT, Addgene plasmid # 45699) and empty vector (pBABE-puro, Addgene plasmid # 51070) were used.

Techniques: Multiplexing, Generated, Expressing

Journal: Nucleic Acids Research

Article Title: HiFENS: high-throughput FISH detection of endogenous pre-mRNA splicing isoforms

doi: 10.1093/nar/gkac869

Figure Lengend Snippet: Specific detection of FGFR2 isoforms. (A–C) Violin and box plots for single cell RNA-HCR-FISH spot count measurements for FGFR2-Full (A), FGFR2-IIIb (B) and PGK1 (C) of each indicated cell line. U2OS cells were infected with virus to overexpress FGFR2-IIIb, FGFR2-IIIc or empty vector (EV). MCF7 and the above-mentioned cells were fixed and stained with RNA-HCR-FISH. Boxes inside violin plot indicate the 25th, 50th (median) and 75th percentile of the distributions and whiskers extend to 1.5X inter-quantile range (IQR). *P < 0.05, ***P < 0.001, ****P < 0.0001. P-values are from a Kruskal–Wallis test, which extends the Mann–Whitney test to multiple samples followed by a post-hoc Dunn test, to compare the different cell lines between each other. Values are generated from single cell data and are representative of three replicates. At least, 500 cells were analyzed per sample. (D) Representative field of view of RNA-HCR-FISH spots for FGFR2-Full, FGFR2-IIIb and PGK1 in cell lines described in A–C. Scale bar: 20 μm.

Article Snippet: Plasmids and virus production Mammalian expression vectors for FGFR2 -IIIb (pBp-FGFR2b-WT, Addgene plasmid # 45698), FGFR2 -IIIc (pBp-FGFR2c-WT, Addgene plasmid # 45699) and empty vector (pBABE-puro, Addgene plasmid # 51070) were used.

Techniques: Infection, Virus, Plasmid Preparation, Staining, MANN-WHITNEY, Generated

Journal: Nucleic Acids Research

Article Title: HiFENS: high-throughput FISH detection of endogenous pre-mRNA splicing isoforms

doi: 10.1093/nar/gkac869

Figure Lengend Snippet: Detection of changes in endogenous FGFR2 isoforms. (A–C) Violin and box plots for RNA-HCR-FISH spot count measurements for multiplexed probes for FGFR2-D7-10 (A), FGFR2-IIIb (B) and TBP (C) in MCF-7 cells. MCF-7 cells were treated with siRNAs against ESRP1 and ESRP2 (si-ESRP-1-2) or scrambled siRNA (si-Control). Cells were fixed 72 h post transfection. Boxes show the 25th, 50th (median) and 75th percentile of the distributions and whiskers extend to 1.5X inter-quantile range (IQR). Values are generated from single cell data and are representative of four replicates. At least, 500 cells were analyzed per sample. (D) Representative field of view of RNA-HCR-FISH for FGFR2-Full, FGFR2-IIIb and TBP in treated (si-ESRP-1-2) and control (si-Control) MCF-7 cells. White arrows indicate FGFR2-IIIb spots. Scale bar: 20 μm. (E, F) Scatter plots of RNA-HCR-FISH spot count measurements for FGFR2-D7-10 (x-axis) and FGFR2-IIIb (y-axis) (E) and for FGFR2-D7-10 (x-axis) and TBP (y-axis) (F) in cells described in (A–C). Number of cells in each plot area is color coded (see legend). Values are generated from single cell data and are representative of four replicates. At least 500 cells were analyzed per sample.

Article Snippet: Plasmids and virus production Mammalian expression vectors for FGFR2 -IIIb (pBp-FGFR2b-WT, Addgene plasmid # 45698), FGFR2 -IIIc (pBp-FGFR2c-WT, Addgene plasmid # 45699) and empty vector (pBABE-puro, Addgene plasmid # 51070) were used.

Techniques: Control, Transfection, Generated

Journal: Nucleic Acids Research

Article Title: HiFENS: high-throughput FISH detection of endogenous pre-mRNA splicing isoforms

doi: 10.1093/nar/gkac869

Figure Lengend Snippet: Isoform specific probes for use in high throughput screen. (A) Outline of HiFENS pipeline in MCF-7 cells. Reverse siRNA transfection and RNA-HCR-FISH protocols are performed in a 384-well format in a fully automated manner followed by automated image acquisition by high-throughput microscopy. Image analysis is performed using Columbus to identify nuclei, cytoplasm, and spots in each cell (see Materials and Methods for details). (B, C) Spot count for FGFR2-Full (B) and FGFR2-IIIb (C) across all six screen plates (plate index) by well position (well index). (D, E) Venn diagram representation for number of genes that decreased (D) or increased (E) spot counts by 1.5 z-score units. (F) Scatter plot for mean z-scores for FGFRF2-Full (y-axis) and FGFR2-IIIb (x-axis). Shaded area highlights plot region in which both FGFR2-Full and FGFR2-IIIb are lower than 1.5 z-score units. Results from all three siRNAs against FGFR family members are indicated. (G) Representative maximum projection images for FGFR2-IIIb in control siRNA well (Si-Control) and siRNA against FGFR2 (Si-FGFR2). Scale bar: 10 μm. (H) Quantitative RT-PCR for FGFR2-Full and for the FGFR2-IIIb isoform. MCF7 cells were treated with the indicated siRNAs. RNA was harvest ed 72 h post transfection. Expression levels are normalized to expression of TBP, and relative to the expression of Scramble siRNA which was arbitrarily set at one. Values represent mean ± SEM of three experiments.

Article Snippet: Plasmids and virus production Mammalian expression vectors for FGFR2 -IIIb (pBp-FGFR2b-WT, Addgene plasmid # 45698), FGFR2 -IIIc (pBp-FGFR2c-WT, Addgene plasmid # 45699) and empty vector (pBABE-puro, Addgene plasmid # 51070) were used.

Techniques: High Throughput Screening Assay, Transfection, Microscopy, Control, Quantitative RT-PCR, Expressing

Journal: Nucleic Acids Research

Article Title: HiFENS: high-throughput FISH detection of endogenous pre-mRNA splicing isoforms

doi: 10.1093/nar/gkac869

Figure Lengend Snippet: Screen Hits for decrease in FGFR2-Full and FGFR2-IIIb levels

Article Snippet: Plasmids and virus production Mammalian expression vectors for FGFR2 -IIIb (pBp-FGFR2b-WT, Addgene plasmid # 45698), FGFR2 -IIIc (pBp-FGFR2c-WT, Addgene plasmid # 45699) and empty vector (pBABE-puro, Addgene plasmid # 51070) were used.

Techniques:

Journal: Nucleic Acids Research

Article Title: HiFENS: high-throughput FISH detection of endogenous pre-mRNA splicing isoforms

doi: 10.1093/nar/gkac869

Figure Lengend Snippet: Screen Hits for increase in FGFR2-Full and FGFR2-IIIb levels

Article Snippet: Plasmids and virus production Mammalian expression vectors for FGFR2 -IIIb (pBp-FGFR2b-WT, Addgene plasmid # 45698), FGFR2 -IIIc (pBp-FGFR2c-WT, Addgene plasmid # 45699) and empty vector (pBABE-puro, Addgene plasmid # 51070) were used.

Techniques: